View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6478_low_17 (Length: 234)
Name: NF6478_low_17
Description: NF6478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6478_low_17 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 234
Target Start/End: Original strand, 52925665 - 52925892
Alignment:
| Q |
7 |
gtatcttggtaaaattgaagaaataaaactgaaattcaaaccccaaactgatttagatttatgaaagagatacaacatctataatgaaaccagaacccgt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
52925665 |
gtatcttggtaaaattgaagaaataaaactgaaattcaaaccccaaactaatttagatttatgaaagagattcaacatctataatgaaaccagaacccat |
52925764 |
T |
|
| Q |
107 |
gcataataaaagtaaagtaatggacagcatcaaggttgcacagcctccaaaagtttctcataaacttgtctagcagtgagatcctccacctgaaatgatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52925765 |
gcataataaaagtaaagtaatggacagcatcaaggttgcacagcctccaaaagtttctcataaacttgtctagcagtgagatcctccacctgaaatgatg |
52925864 |
T |
|
| Q |
207 |
gtgaaaattagcgttagtatatatgttt |
234 |
Q |
| |
|
|||||||||||| ||||||||||||||| |
|
|
| T |
52925865 |
gtgaaaattagcattagtatatatgttt |
52925892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University