View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6480_high_13 (Length: 261)
Name: NF6480_high_13
Description: NF6480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6480_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 31503900 - 31503671
Alignment:
| Q |
16 |
ctcacagggtggttagagatggtgttggttttgcatggttgtttgttttgctgcgagatggttaggggagatagtggacgtgtaagtttgagtggtggtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31503900 |
ctcacagggtggttagagatggtgttggttttgcatggttgtttgttttgctgcgagatggttaggggagatagtggaggtgtaagtttgagtggtggtt |
31503801 |
T |
|
| Q |
116 |
tatggtaattgtagtggtgtggttggaaggggtggtcgtggataatctggacttagatctgaagtcgaaacatttgatcgacgagagctgattaacaggg |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31503800 |
tatggtaattgtagtggcgtggttggaaggggtggtcgtggataatctagactcagatctgaagtcgaaacatttgatggacgagagctgattaacaggg |
31503701 |
T |
|
| Q |
216 |
gatggtagacattggttaggtaggaaggtg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31503700 |
gatggtagacattggttaggtaggaaggtg |
31503671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 67 - 168
Target Start/End: Complemental strand, 1820583 - 1820481
Alignment:
| Q |
67 |
tgcgagatggttaggggagatagtggacgtgtaagtttgagtggtggtttatggtaattgtagtggtgtggttggaa-ggggtggtcgtggataatctgg |
165 |
Q |
| |
|
|||||||||||| |||||| |||| | |||| ||||||||||| ||||||||| |||||||||||||| ||| ||||||||||||||||||| || |
|
|
| T |
1820583 |
tgcgagatggttgggggaggaagtgtaggtgttggtttgagtggtcatttatggtagcagtagtggtgtggtttgaatggggtggtcgtggataatccgg |
1820484 |
T |
|
| Q |
166 |
act |
168 |
Q |
| |
|
||| |
|
|
| T |
1820483 |
act |
1820481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 70 - 175
Target Start/End: Original strand, 5746229 - 5746335
Alignment:
| Q |
70 |
gagatggttaggggagatagtggacgtgtaagtttgagtggtggtttatggtaattgtagtggtgtggt-tggaaggggtggtcgtggataatctggact |
168 |
Q |
| |
|
||||||||| |||||| |||| | |||| || |||||||||| |||||||| |||| |||||||| |||| |||||||||||||||||| |||||| |
|
|
| T |
5746229 |
gagatggttgggggaggaagtgcaggtgttagattgagtggtgatttatggtggcggtagcggtgtggtctggatggggtggtcgtggataatttggact |
5746328 |
T |
|
| Q |
169 |
tagatct |
175 |
Q |
| |
|
|||||| |
|
|
| T |
5746329 |
cagatct |
5746335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University