View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6480_high_9 (Length: 308)
Name: NF6480_high_9
Description: NF6480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6480_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 298
Target Start/End: Complemental strand, 1946016 - 1945736
Alignment:
| Q |
19 |
tcaagtagtggtggaatccgaatgagtgttcggataaggtannnnnnnnngtgtttaattgggctcaactgtgatgatgtgaggaaaaggttccgtttac |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||| | |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1946016 |
tcaagtagtgatggaatccgaatgagtgcttggataaggtatttttttttgtgtttaattgggctcaactgtgatgatgtgaggaaaaggttccgtttac |
1945917 |
T |
|
| Q |
119 |
agagattttgattggtttaatggnnnnnnn-agggggtttggtctgagcagtcacaagagatgtttggaatttgtttgtgtggttatttgcgatggagtt |
217 |
Q |
| |
|
|| ||||||||||||||| |||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1945916 |
agggattttgattggtttgatgggtttttttagggggtttggtctcagcagtcacaagaggtgtttggaatttgtttgtgtggttatttgcgatggagtt |
1945817 |
T |
|
| Q |
218 |
tgtggttttagctaagttttatttatgtagttgtgtggaaatttggatttgatttaggtgttagaacttagttttgatgat |
298 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1945816 |
tgtggttttagccaagtttgatttatgtagttgtgtggaaatttggatttgatttaggtgttagaacttagttttggtgat |
1945736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University