View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6480_low_18 (Length: 202)

Name: NF6480_low_18
Description: NF6480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6480_low_18
NF6480_low_18
[»] chr2 (1 HSPs)
chr2 (1-186)||(38000932-38001117)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 38001117 - 38000932
Alignment:
1 tgacatcttatcatggcaagaactagttggtgcaggccccattcgaattgcagaaggtgaagtttggtgattgttacaatttaccaaatgaattacctca 100  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38001117 tgacatcttatcatggcaagaactagttggttcaggccccattcgaattgcagaaggtgaagtttggtgattgttacaatttaccaaatgaattacctca 38001018  T
101 gttggaataccaaatataatttttgagatgaatcgtaaacatgtagttggtgatggcgcagctaaaacagttacaccataaaatgg 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
38001017 gttggaataccaaatataatttttgagatgaatcgtaaacatgtagttggtgatggcgcagctaaaacagttagaccataaaatgg 38000932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University