View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6480_low_4 (Length: 428)
Name: NF6480_low_4
Description: NF6480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6480_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 23 - 294
Target Start/End: Complemental strand, 41457702 - 41457431
Alignment:
| Q |
23 |
tatttagttgaaattttgtccaaaaacattagttgaaaagttctgttcaatatcatggacaggtcgacgcataagataaagtgttgaaaagttaaaacac |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41457702 |
tatttagttgaaattttgtccaaaaacattagttgaaaagttctgttcaatataatggacaggtcgacgcataagataaagtgttgaaaagttaaaacac |
41457603 |
T |
 |
| Q |
123 |
ggttgcgcaattcaattgcaattgcaattagtgcttactgaatcatttatttttagtggcaaccacacggcattgtatccttttaccaacatagcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41457602 |
ggttgcgcaattcaattgcaattgcaattggtgcttactgaatcatttatttttagtggcaaccacacggcattgtatccttttactaacatagcctcat |
41457503 |
T |
 |
| Q |
223 |
caaagacattacaaagcgaattgcatccttgtatctgaacgtaatttactgcatggggtagagagaggcggc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41457502 |
caaagacattacaaagcgaattgcatccttgtatctgaacgtaatttactgcatggggtagagagaggcggc |
41457431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 292 - 412
Target Start/End: Complemental strand, 41457319 - 41457199
Alignment:
| Q |
292 |
ggcgggttcttgacttcggagattatctcttactagaccgaattaagaagctcttgttgccttggaagagtcgtcatttgtctgtgggaggatcgtttga |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||| |
|
|
| T |
41457319 |
ggcgggttcttgacttcggagattatctcttacaagaccgaattaagaagctcttgttgccttggaagagtcatcatttgtctgtgcggggatcgtttga |
41457220 |
T |
 |
| Q |
392 |
tactttttgaaatatgtcctg |
412 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41457219 |
tactttttgaaatatgtcctg |
41457199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University