View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6482_high_2 (Length: 304)
Name: NF6482_high_2
Description: NF6482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6482_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 98 - 291
Target Start/End: Complemental strand, 51458065 - 51457872
Alignment:
| Q |
98 |
gtgagagatgagagactaaccaagaagctttgtagcacccaagagactgttaagtccatcatactcgcatgatttgacatgaacaataccttgaacaaca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51458065 |
gtgagagatgagagactaaccaagaagctttgtagcacccaagagactgttaagtccatcatactcgcatgatttgacatgaacaataccttgaacaaca |
51457966 |
T |
 |
| Q |
198 |
ttgaagcttctagggcaaggagtgggatgcaattgtgggtgagttggaacaacaggtgtgcgaacacgggcaggagctggagggtgatgatggt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51457965 |
ttgaagcttctagggcaaggagtgggatgcaattgtgggtgagttggaacaacaggtgtgcgaacacgggcaggagctggagggtgatgatggt |
51457872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 51458160 - 51458119
Alignment:
| Q |
1 |
ttattgaaggagagaaataaataaaagaaatctgtatctacc |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51458160 |
ttattgaaggagagaaataaataaaagaaatatgtatctacc |
51458119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 35327003 - 35327084
Alignment:
| Q |
157 |
catactcgcatgatttgacatgaacaataccttgaacaacattgaagcttctagggcaaggagtgggatgcaattgtgggtg |
238 |
Q |
| |
|
|||||| ||| |||||||||| ||||| |||||||||| | | |||||||||||| ||||| ||||||||| ||||||| |
|
|
| T |
35327003 |
catacttgcaagatttgacataaacaacaccttgaacagctataaagcttctagggaggggagtaggatgcaatggtgggtg |
35327084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University