View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6483_high_2 (Length: 413)
Name: NF6483_high_2
Description: NF6483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6483_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 385; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 385; E-Value: 0
Query Start/End: Original strand, 13 - 397
Target Start/End: Original strand, 41151972 - 41152356
Alignment:
| Q |
13 |
gaaacataggagatgggcaagatgttctagtaagagtgcattcagaatgtttaactggggatatatttggatcagctcggtgtgactgtggccagcaact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41151972 |
gaaacataggagatgggcaagatgttctagtaagagtgcattcagaatgtttaactggggatatatttggatcagctcggtgtgactgtggccagcaact |
41152071 |
T |
|
| Q |
113 |
agatttggctatggaattgattgaagaagctggaagaggagtaattgtttatcttagaggtcatgaaggaagaggcattgggttgggtcacaaacttcaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41152072 |
agatttggctatggaattgattgaagaagctggaagaggagtaattgtttatcttagaggtcatgaaggaagaggcattgggttgggtcacaaacttcaa |
41152171 |
T |
|
| Q |
213 |
gcctataacttgcaagatcaaggtcgtgatacagtccaagcaaacatagatttagggttagctgttgatgctcgtgagtatggcattggtgcccaggtca |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41152172 |
gcctataacttgcaagatcaaggtcgtgatacagtccaagcaaacatagatttagggttagctgttgatgctcgtgagtatggcattggtgcccaggtca |
41152271 |
T |
|
| Q |
313 |
gatcttttaatcactttcacttacattgtttgtgtgcttcaaatcaaataaagtatacgtatgattggatttctcaaattagtca |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41152272 |
gatcttttaatcactttcacttacattgtttgtgtgcttcaaatcaaataaagtatacgtatgattggatttctcaaattagtca |
41152356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University