View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6483_high_5 (Length: 370)
Name: NF6483_high_5
Description: NF6483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6483_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 6e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 195 - 358
Target Start/End: Complemental strand, 5179566 - 5179406
Alignment:
| Q |
195 |
ttaattag-accatacttttgaaaaggaaaacataattagacgttcattaattagtaccttgttagttaattgggttagnnnnnnnnnnnnnntccgtcc |
293 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5179566 |
ttaattagtaccatacttttgaaaaggaaaacataattagacgttcattaattagtaccttgttagttaattgggttag----aaaaaaaaaatccgtcc |
5179471 |
T |
 |
| Q |
294 |
atccatctaacttgataagattcattatactgtattgtccaccatacttttgtatgaaactattg |
358 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5179470 |
atccatctaacttgataagattcattatagtgtattgtccaccatacttttgtatgaaactattg |
5179406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University