View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6483_high_9 (Length: 226)
Name: NF6483_high_9
Description: NF6483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6483_high_9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 62 - 226
Target Start/End: Complemental strand, 48203875 - 48203711
Alignment:
| Q |
62 |
aaaataaaccaaataaaaacatcaagctgtaaccctaattttgctttcttcttcgcttcgtttttgtctggagtatagcgaaacctcggcaacagttcac |
161 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48203875 |
aaaaaaaaccaaataaaaacatcaagctgtaaccctaattttgctttcttcttcacttcgtttttgtctggagtatagcgaaacctcggcaacagttcac |
48203776 |
T |
 |
| Q |
162 |
gtttacagtgaagctataactactagcttgtcaatttcgcagaacaatgggtaaagctaagaaag |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48203775 |
gtttacagtgaagctataactactagcttgtcaatttcgcagaacaatgggtaaagctaagaaag |
48203711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 67 - 226
Target Start/End: Original strand, 32399272 - 32399434
Alignment:
| Q |
67 |
aaaccaaataaaaacatcaagc---tgtaaccctaattttgctttcttcttcgcttcgtttttgtctggagtatagcgaaacctcggcaacagttcacgt |
163 |
Q |
| |
|
|||||||||||||||||| | | ||||||||||||||||||||||||||| |||||||| ||| | ||| |||||||||||||||||| ||||||||| |
|
|
| T |
32399272 |
aaaccaaataaaaacatcgatcagttgtaaccctaattttgctttcttcttcacttcgtttgtgtatagaggatagcgaaacctcggcaagagttcacgt |
32399371 |
T |
 |
| Q |
164 |
ttacagtgaagctataactactagcttgtcaatttcgcagaacaatgggtaaagctaagaaag |
226 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
32399372 |
ttacagtgaagctacaactactagcttgtcaatttcacagaacaatgggtaatgctaagaaag |
32399434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University