View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6484_low_2 (Length: 284)
Name: NF6484_low_2
Description: NF6484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6484_low_2 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 2 - 284
Target Start/End: Original strand, 3684147 - 3684429
Alignment:
| Q |
2 |
ttagttgtctttttatctgataataatgaaaggttgttctataggtcccgcaggatgctcacttccctctcgagtcctaactcttgatccctcaagttca |
101 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3684147 |
ttagttgtctttttatctaataataatgaaaggttgttctataggtccctcaagatgctcacttccctctcgagtcctgactcttgatccctcaagttca |
3684246 |
T |
|
| Q |
102 |
gtagtttaaattggatatgtcctcaatttcgtttaagatttcatcggtagttatggtcgaaaggatcgagagttagaatatgatatgttcatgatctaac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3684247 |
gtagtttaaattggatatgtcctcaatttcgtttaagatttcatcggtagttatggtcgaaaggatcgagagttagaatatgatatgttcatgatctaac |
3684346 |
T |
|
| Q |
202 |
ttagggaaattttacagtaccaagcacatggttcaataaccactcatatttttaacaacaatatccaaaacacataattcaac |
284 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3684347 |
ttagggaaattttacggtaccaagcacatggttcaataaccactcatatttttaacaacaatatccaaaacacataattcaac |
3684429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University