View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6484_low_4 (Length: 267)
Name: NF6484_low_4
Description: NF6484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6484_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 257
Target Start/End: Complemental strand, 52610373 - 52610136
Alignment:
| Q |
19 |
catgaaccccacttttgggcatcaatcacaaattcgtacgttgtgataagggagtgcatactcccattcatcaaggtgtctgatctatgtaatttcagac |
118 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| | |||||| |||||| ||||||||||||||||||| ||| || |
|
|
| T |
52610373 |
catgaaccccacttttggggatcaattacaaattcgtacgttgtgataagggagtggaacctcccagtcatcagggtgtctgatctatgtaatctcaaac |
52610274 |
T |
|
| Q |
119 |
cttcaaaaaattatcaaaattagagtacaaagatcgaagacgcatgacttcctcagctatccaaggatatttgctcgcattagaaggtaggtcttgactt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52610273 |
cttcaaaaaattatcaaaattagagtacaaaggtcaaaggcgcatgactttctcagctatccaaggatatttgctcgcattagaaggtaggtcttgactt |
52610174 |
T |
|
| Q |
219 |
cccccaaatgggttactctactctcttcactctcatatt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52610173 |
-ccccaaatgggttactctactctcttcactctcatatt |
52610136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University