View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6485_high_2 (Length: 267)
Name: NF6485_high_2
Description: NF6485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6485_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 27 - 143
Target Start/End: Complemental strand, 13631798 - 13631682
Alignment:
| Q |
27 |
ttaacatcaagagacgaaagaaatagaaagagtaccacttagaagccttaaaaccctgagcgaaaaacgaattgagcatcgacatcgttaacgttttcaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13631798 |
ttaacatcaagagacgaaagaaatagaaagagtaccacttagaagccttaaaaccctgagcgaaaaacgaattgagcatcgacatcgttaacgttttcaa |
13631699 |
T |
 |
| Q |
127 |
ctttcgatcaaaatcac |
143 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13631698 |
ctttcgatcaaaatcac |
13631682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 209 - 267
Target Start/End: Complemental strand, 13631617 - 13631559
Alignment:
| Q |
209 |
gggtaaatgtgtaattatacttaagaaagatgatataaagtgcgcgtgataatgatttt |
267 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13631617 |
gggtaaatgtgtaattatacctaagaaagatgatataaagtgcgcgtgataatgatttt |
13631559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University