View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6486_low_5 (Length: 246)
Name: NF6486_low_5
Description: NF6486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6486_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 70 - 226
Target Start/End: Complemental strand, 1241156 - 1241000
Alignment:
| Q |
70 |
aaaaaactcaatatgaaaccttcaacagaatcaaccaaggacacagccattgacattgataattcatcttccaaaagagtatctttctctgaccaacagc |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1241156 |
aaaaaactcaatatgaaaccttcaacagaatcaaccaaggacacaaccattgacattgataattcatcttccaaaagagtatctttctctgaccaacagc |
1241057 |
T |
|
| Q |
170 |
aacagcaccaacacaatgttcctttgttacttcaaccatcttatgcaagatcaaaat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1241056 |
aacagcaccaacacaatgttcctttgttacttcagccatcttatgcaagatcaaaat |
1241000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University