View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6487_high_36 (Length: 249)
Name: NF6487_high_36
Description: NF6487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6487_high_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 15 - 110
Target Start/End: Original strand, 7908473 - 7908568
Alignment:
| Q |
15 |
cagagatgatatgcaaatagcggaggatagagtgaaatgtctccaaaacattctgcaggtccgtttatctcaagtcatgaatcagtgagtatcaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7908473 |
cagagatgatatgcaaatagcggaggatatagtgaaatgtctccaaaacattctgcaggtccgtttatctcaagtcatgaatcagtgagtatcaaa |
7908568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University