View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6487_high_38 (Length: 247)
Name: NF6487_high_38
Description: NF6487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6487_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 8 - 227
Target Start/End: Complemental strand, 9115846 - 9115627
Alignment:
| Q |
8 |
tggacctacacataccaccatggaggagaaatttgtacatgcaaaccaaatggtttagttcttacaaaagaacaatcaatgcagttgcaactataaaagc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9115846 |
tggacctacacataccaccatggaggagaaatttgtacatgcaaaccaaatggtttagttcttacaaaagaacaaccaatgcagttgcaactataaaagc |
9115747 |
T |
 |
| Q |
108 |
atcttcacatttttcagctgagtctttttgtcctaaaaagtttatgggatttgaagctcgacatgtgaaagcatataattgtagggatgattatgtgggg |
207 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9115746 |
atcttcacatttttcagttgagtctttttgtcctaaaaagtttatgggatttgaagctcgacatgtgaaagcatataattgtagggatgattatgtgggg |
9115647 |
T |
 |
| Q |
208 |
attaataatgggtttagggt |
227 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
9115646 |
attaataatgggtttagggt |
9115627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University