View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6487_high_42 (Length: 233)

Name: NF6487_high_42
Description: NF6487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6487_high_42
NF6487_high_42
[»] chr3 (1 HSPs)
chr3 (1-220)||(29103322-29103539)
[»] chr5 (1 HSPs)
chr5 (101-180)||(32789277-32789356)


Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 29103322 - 29103539
Alignment:
1 catcgatagactctattatttttagtaaatttaatgaaagagaaatttttatcgatccattgatagagaataaaatgtttgattgnnnnnnnttgtgatt 100  Q
    ||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||       || |||||    
29103322 catcgatagact--attatttttagtaaatttaatgaaagagaaatttttatcgatccatcgatagagaataaaatgtttgattgaaaaaaattttgatt 29103419  T
101 tcaggatgcatatgctctttgccgtatattcaagaagagtacagtgattgctccaaaagttggggagcaatatgttaataatgttgccaggcatgcaaat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
29103420 tcaggatgcatatgctctttgccgtatattcaagaagagtacagtgattgctccaaaaattggggagcaatatgttaataatgttgccaggcatgcaaat 29103519  T
201 catattacaagtgatcaatc 220  Q
    ||||||||||||||||||||    
29103520 catattacaagtgatcaatc 29103539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 101 - 180
Target Start/End: Complemental strand, 32789356 - 32789277
Alignment:
101 tcaggatgcatatgctctttgccgtatattcaagaagagtacagtgattgctccaaaagttggggagcaatatgttaata 180  Q
    ||||||||||||||||||||||||| |  |||||||||||||||||||||  ||||||||||| |  ||||||| |||||    
32789356 tcaggatgcatatgctctttgccgtgtgatcaagaagagtacagtgattgtgccaaaagttggaggacaatatggtaata 32789277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University