View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6487_low_29 (Length: 291)
Name: NF6487_low_29
Description: NF6487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6487_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 275
Target Start/End: Complemental strand, 36222441 - 36222176
Alignment:
| Q |
11 |
cataggcatagtaggtttttgatgtttgaattggttctcggaatttcaaatgtcattcaaaatgagctctctgttaacttccaacattataggctatgac |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36222441 |
catagtcatagtaggtttttgatgtttgaattggttctcggaatttcaaatgtcattcaaaatgagctctctattaacttccaacattataggctatgac |
36222342 |
T |
 |
| Q |
111 |
atataattgaacatgtcacattacacattgatcacacatcaatgtcagctcgccaatgactaatctcactacgaaatttagaccaacttatagggactaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36222341 |
atataattgaacatgtcacattacacattgatcacacatcaatgccagctcgccaatgactaatctcactacgaaatttagaccaacttatagggactaa |
36222242 |
T |
 |
| Q |
211 |
tttatcggtgattgcaatcatgca-tggctaattaccaacaaattcgtttcgagagacataaatta |
275 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36222241 |
tttatcggtgattgcaatcatgcattgactaattaccaacaaattcgtttcgagagacataaatta |
36222176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University