View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6487_low_32 (Length: 259)
Name: NF6487_low_32
Description: NF6487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6487_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 122519 - 122291
Alignment:
| Q |
13 |
aatataaattcggaagtaaaacatatgactttctaccctgttcaattcaaacctatattatttggtaaaaacagatcgcagttatgcagaatggcccacc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
122519 |
aatataaattcggaagtaaaacatatgactttctaccctgttcaattcaaacctatattatttggtaaaaacagatcgcagttatgcagaatggcccacc |
122420 |
T |
 |
| Q |
113 |
atatcatcactcacctatgnnnnnnnnntgtgagcaggtttgcacaacagtgaatgcaatgaagcaagtgcaagtgcaacaaccaattttcaaactataa |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
122419 |
atatcatcactcacctatgaaaaaaaaatgtgagcaggtttgcacaacagtgaatgcaatgaagcaagtgcaagtgcaacaaccaattttcaaactataa |
122320 |
T |
 |
| Q |
213 |
atctttgaccataatttcaaggaaaagct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
122319 |
atctttgaccataatttcaaggaaaagct |
122291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 13 - 131
Target Start/End: Complemental strand, 18850241 - 18850123
Alignment:
| Q |
13 |
aatataaattcggaagtaaaacatatgactttctaccctgttcaattcaaacctatattatttggtaaaaacagatcgcagttatgcagaatggcccacc |
112 |
Q |
| |
|
|||||||||| ||||||||||||||| | ||||| || ||||||||| ||||||||||||||||||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
18850241 |
aatataaatttggaagtaaaacatatcattttctcccttgttcaatttaaacctatattatttggtaaaaatagatcgcaattatgcagtctggcccacc |
18850142 |
T |
 |
| Q |
113 |
atatcatcactcacctatg |
131 |
Q |
| |
|
| |||||||||| |||||| |
|
|
| T |
18850141 |
aaatcatcactcgcctatg |
18850123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University