View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6487_low_39 (Length: 247)

Name: NF6487_low_39
Description: NF6487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6487_low_39
NF6487_low_39
[»] chr2 (1 HSPs)
chr2 (8-227)||(9115627-9115846)


Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 8 - 227
Target Start/End: Complemental strand, 9115846 - 9115627
Alignment:
8 tggacctacacataccaccatggaggagaaatttgtacatgcaaaccaaatggtttagttcttacaaaagaacaatcaatgcagttgcaactataaaagc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
9115846 tggacctacacataccaccatggaggagaaatttgtacatgcaaaccaaatggtttagttcttacaaaagaacaaccaatgcagttgcaactataaaagc 9115747  T
108 atcttcacatttttcagctgagtctttttgtcctaaaaagtttatgggatttgaagctcgacatgtgaaagcatataattgtagggatgattatgtgggg 207  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9115746 atcttcacatttttcagttgagtctttttgtcctaaaaagtttatgggatttgaagctcgacatgtgaaagcatataattgtagggatgattatgtgggg 9115647  T
208 attaataatgggtttagggt 227  Q
    ||||||||||||||||||||    
9115646 attaataatgggtttagggt 9115627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University