View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6488_high_9 (Length: 343)
Name: NF6488_high_9
Description: NF6488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6488_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 16 - 332
Target Start/End: Original strand, 35303775 - 35304091
Alignment:
| Q |
16 |
tcatctactttacacgtgagctccatcatacaaatatcaggctccacatgagtgctgatacttggaaaggatcttcgtcaacttttattggtggttcttc |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35303775 |
tcatctactttacacatgagctccatcatacaaatatcaggctccacatgagtgctgatacttggaaaggatcttcgtcaacttttataggtggttcttc |
35303874 |
T |
|
| Q |
116 |
aaagactaaacattcttcttcaattgtattttgaatcatatctctaagatgaatacaagaattagtatgatggtcataagtagtaaaatactttcttcct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35303875 |
aaagactaaacattcttcttcaattgtattttgaatcatatctctaagacgaatacaagaattagtatgatggtcataagtagtataatactttcttcct |
35303974 |
T |
|
| Q |
216 |
caaatttgttttggaagaagaattttatgacatttacttaataatatttacttatctttttaaaagaatatcaaatatttaatcatatttgttttatgtc |
315 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35303975 |
caaatttgtttcggaagaagaattttatgacatttacttaataatatttacttatctttttaaaagaatatcaaatatttaatcatatttgttttatgtc |
35304074 |
T |
|
| Q |
316 |
aaacacatattcttcga |
332 |
Q |
| |
|
|||||||| || ||||| |
|
|
| T |
35304075 |
aaacacatgtttttcga |
35304091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University