View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6488_low_18 (Length: 218)
Name: NF6488_low_18
Description: NF6488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6488_low_18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 7224250 - 7224035
Alignment:
| Q |
1 |
taactatatagaaactcaaccaaataatttttgagaacatgactattattattacaccaaacacgtttaagaaaaacaagttgagaataagtggccatag |
100 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7224250 |
taactatatagaaactctaccaaatattttttgagaacatgactattattattacaccaaacacgtttaagaaaaacaagttgagaataagtggccatag |
7224151 |
T |
|
| Q |
101 |
ttccaagggggaattatgaaccatatgaaacgaacgcccctagcagctgtaataacctttatcaggtttcatttgattaaaagaatggtctaacatgaat |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7224150 |
ttccaa-ggggaattatgaaccatatgaaacgaacgcccctagcagctgtaataacctttatcaggtttcatttgattaaaagaatggtctaacatgaat |
7224052 |
T |
|
| Q |
201 |
gggttagttatcttacca |
218 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7224051 |
-ggttagttatcttacca |
7224035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University