View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6490_high_4 (Length: 287)
Name: NF6490_high_4
Description: NF6490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6490_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 19 - 282
Target Start/End: Complemental strand, 1936610 - 1936347
Alignment:
| Q |
19 |
ttttttgtattaaatgtttaggacaggagtctcaatacatcagttttatggatttaatgatgatgccagattttccaccagttttgcaaccaacaatctc |
118 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1936610 |
ttttttgtgttaaatgtttaggacacgagtctcaatacatcagttttatggatttaatgatgatgccagattttccaccagttttgcaaccaacaatctc |
1936511 |
T |
 |
| Q |
119 |
cacgctatcgataaaaatcatagagaagttcgaattgtcgttgttgaggaccgctatacttgtaaatcaattttagagatgacaaatgttccaatcattc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1936510 |
cacgctatcgataaaaatcatagagaagttcgaattgtcgttgttgaggaccgctatacttgtaaatcaattttagagatgacaaatgttccaatcattc |
1936411 |
T |
 |
| Q |
219 |
acgcaggttgtagatgtgaactgctcacatggaataacagtcttcaattgcaatctgtgctcct |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1936410 |
acgcaggttgtagatgtgaactgctcacatggaataacagtcttcaattgcaatctgtgatcct |
1936347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University