View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6490_high_7 (Length: 238)
Name: NF6490_high_7
Description: NF6490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6490_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 34957871 - 34957989
Alignment:
| Q |
1 |
gattgggtgaagactagttatttgcttgagaatattggatgatattcgtaaaagtaacgaataattatgtgcttgagaataaaatatgttgccacaataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34957871 |
gattgggtgaagactagttatttgcttgagaatattggatgatattcataaaagtaacgaataattatgtgcttgagaataaaatatgttgccacaataa |
34957970 |
T |
 |
| Q |
101 |
gcatggaaacagttctgag |
119 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
34957971 |
gcatgggaacagttctgag |
34957989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 165 - 227
Target Start/End: Original strand, 34958044 - 34958106
Alignment:
| Q |
165 |
tttaagctctaggctatacatttcttaaacttcagactttggttttggtgcttgaatttgatg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34958044 |
tttaagctctaggctatacatttcttaaacttcagactttggttttggtgcttgaatttgatg |
34958106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 59 - 119
Target Start/End: Original strand, 34953704 - 34953764
Alignment:
| Q |
59 |
gaataattatgtgcttgagaataaaatatgttgccacaataagcatggaaacagttctgag |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34953704 |
gaataattatgtgcttgggaataaaatatgttgccataataagcatggaaacagttctgag |
34953764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 227
Target Start/End: Original strand, 34953821 - 34953883
Alignment:
| Q |
165 |
tttaagctctaggctatacatttcttaaacttcagactttggttttggtgcttgaatttgatg |
227 |
Q |
| |
|
|||||||| |||||| |||||||||| | ||||||||||||| ||||||||||||| |||||| |
|
|
| T |
34953821 |
tttaagctttaggctttacatttcttcaccttcagactttggctttggtgcttgaaattgatg |
34953883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 220
Target Start/End: Original strand, 34947165 - 34947220
Alignment:
| Q |
165 |
tttaagctctaggctatacatttcttaaacttcagactttggttttggtgcttgaa |
220 |
Q |
| |
|
|||||||| |||||| |||||||||| | ||||||||||||| |||||||||||| |
|
|
| T |
34947165 |
tttaagctataggctttacatttcttcaccttcagactttggccttggtgcttgaa |
34947220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 83 - 119
Target Start/End: Original strand, 34947075 - 34947111
Alignment:
| Q |
83 |
aatatgttgccacaataagcatggaaacagttctgag |
119 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
34947075 |
aatatgttgccataataagcatggaaacagttttgag |
34947111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University