View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6490_low_12 (Length: 218)
Name: NF6490_low_12
Description: NF6490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6490_low_12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 11 - 218
Target Start/End: Complemental strand, 12940238 - 12940031
Alignment:
| Q |
11 |
catcatcaagggcatattcagattcacttgatcgacgatacttaagaatcataatgtgtcggcttgattacaaaaactctccacttatcaatatcaacat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12940238 |
catcatcaagggcatattcagattcacttgatcgacgatacttaagaatcataatgtgttggcttgattacaaaaactctccacttatcaatatcaacat |
12940139 |
T |
|
| Q |
111 |
ttaaaactactcgaagccttgcaggacacttagtttgagtgatcagcctcgaattaatatcttgactctttcttcttatttttactctcaccctctctat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
12940138 |
ttaaaactactcgaagccttgcaggacacttagtttgagtgatcagcctcaaattaatatcttgattgtttcttcttatttttactctcaccctctctat |
12940039 |
T |
|
| Q |
211 |
tacatatt |
218 |
Q |
| |
|
|||||||| |
|
|
| T |
12940038 |
tacatatt |
12940031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University