View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6491_high_7 (Length: 274)
Name: NF6491_high_7
Description: NF6491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6491_high_7 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 22 - 274
Target Start/End: Original strand, 5948045 - 5948293
Alignment:
| Q |
22 |
tgacatacttagatgcgtaaccctggctgttggcatggttaaattggccgagtttgcaaaacaccaccgcctctgggtgggataagtgaagccatttcat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5948045 |
tgacatacttagatgcgtaaccctggctgttggcatggttaaattggccgagtttgcaaaacaccaccgcct----atgggataagtgaagccatttcat |
5948140 |
T |
 |
| Q |
122 |
ttgatttgtacatagttggttattggttattgaggttggcatggttaaatttcatctcattattgtaggagaaatataattttatatgtaatcactattc |
221 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5948141 |
ttgatttgtacattgttggttattggttattgaggttggcatggttaaatttcatctcattattgtaggagaaatataattttatatgtaatcactattc |
5948240 |
T |
 |
| Q |
222 |
tcagtcagagactagtttttgtcttagtcctcagaacagttattattcagcca |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5948241 |
tcagtcagagactagtttttgtcttagtcctcagaacagttattattcagcca |
5948293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 215 - 274
Target Start/End: Original strand, 395378 - 395437
Alignment:
| Q |
215 |
actattctcagtcagagactagtttttgtcttagtcctcagaacagttattattcagcca |
274 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
395378 |
actattctcagccagagactagtttttgtcttagtcctcagaacagttactattcagcca |
395437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University