View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6492_high_8 (Length: 229)

Name: NF6492_high_8
Description: NF6492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6492_high_8
NF6492_high_8
[»] chr5 (1 HSPs)
chr5 (50-205)||(43407902-43408057)


Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 50 - 205
Target Start/End: Original strand, 43407902 - 43408057
Alignment:
50 atcaagcagatataattgaggagctcttgggagaaggttgctggattgaagcaagtgagaacagtttgatgtccatgcagcaaactacgccacaatcaca 149  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||    
43407902 atcaagcagatataattgaggagctgttgggagaaggttgctggattgaagcaagtgagaatagtttgatggccatgcagcaaactacgccacaatcaca 43408001  T
150 atacatgtccaacaataataatattcctatgggaatgggagagggagatcacttca 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43408002 atacatgtccaacaataataatattcctatgggaatgggagagggagatcacttca 43408057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University