View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6492_low_15 (Length: 229)
Name: NF6492_low_15
Description: NF6492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6492_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 50 - 205
Target Start/End: Original strand, 43407902 - 43408057
Alignment:
| Q |
50 |
atcaagcagatataattgaggagctcttgggagaaggttgctggattgaagcaagtgagaacagtttgatgtccatgcagcaaactacgccacaatcaca |
149 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43407902 |
atcaagcagatataattgaggagctgttgggagaaggttgctggattgaagcaagtgagaatagtttgatggccatgcagcaaactacgccacaatcaca |
43408001 |
T |
 |
| Q |
150 |
atacatgtccaacaataataatattcctatgggaatgggagagggagatcacttca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408002 |
atacatgtccaacaataataatattcctatgggaatgggagagggagatcacttca |
43408057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University