View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6492_low_16 (Length: 203)
Name: NF6492_low_16
Description: NF6492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6492_low_16 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 3 - 203
Target Start/End: Complemental strand, 22278754 - 22278554
Alignment:
| Q |
3 |
atccatcttttgttatagttgacagtgttcaggtggagggggcgtctgacgtgcgtagtgttgtctttgaacattttaaggctaggaatgagatcagaca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22278754 |
atccatcttttgttatagttgacagtgttcaggtggagggggcgtctgacgtgcgtagtgttgtctttgaacattttaaggctaggaatgagatcagaca |
22278655 |
T |
 |
| Q |
103 |
tgtggtggatgatttacattttcgtagtttgtctcgtgtcttgattaaactattcaatttcgaggaagttaaagtggagatctgggactgttttaagagt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22278654 |
tgtggtggatgatttacattttcgtagtttgtctcatgtcttgattaaactattcaatttcgaggaagttaaagtggagatctgggactgttttaagagt |
22278555 |
T |
 |
| Q |
203 |
t |
203 |
Q |
| |
|
| |
|
|
| T |
22278554 |
t |
22278554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University