View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6492_low_3 (Length: 482)
Name: NF6492_low_3
Description: NF6492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6492_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 384; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 384; E-Value: 0
Query Start/End: Original strand, 87 - 474
Target Start/End: Original strand, 44798760 - 44799147
Alignment:
| Q |
87 |
cgatggcattgcttttctcatttcatcaaccactgatttctcgtctctctctaatggttacatgggccttcctcattctgatcaagattcttactttgcg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798760 |
cgatggcattgcttttctcatttcatcaaccactgatttctcgtctctctctaatggttacatgggccttcctcattctgatcaagattcttactttgcg |
44798859 |
T |
 |
| Q |
187 |
gttgaatttgatacaagttttgatccttctcttggtgacattaatggaaaccacgttggtattgatcttggcagtgttgtttcttttgcttctgctgatc |
286 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798860 |
gttgaatttgatacgagttttgatccttctcttggtgacattaatggaaaccacgttggtattgatcttggcagtgttgtttcttttgcttctgctgatc |
44798959 |
T |
 |
| Q |
287 |
ttctttcacgtcggattgatttgaaaagtgggaaaatcatcaatgcatggattgagtatagagatgatatgaaaatggttcgtgtttgggttagttactc |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798960 |
ttctttcacgtcggattgatttgaaaagtgggaaaatcatcaatgcatggattgagtatagagatgatatgaaaatggttcgtgtttgggttagttactc |
44799059 |
T |
 |
| Q |
387 |
ttcaactagacctccaacaccaattattgcttcattcattgatctttctgagagatttaaagagtttatgcatgttggtttctctgct |
474 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44799060 |
ttcaactagacctccaacaccaattattgcttcattcattgatctttctgagagatttaaagagtttatgcatgttggtttctctgct |
44799147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University