View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6492_low_4 (Length: 450)
Name: NF6492_low_4
Description: NF6492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6492_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 4e-79; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 14 - 207
Target Start/End: Original strand, 7478466 - 7478658
Alignment:
| Q |
14 |
aggagcaagcaaacatcatagcatgattcttcatgtcatagacaaaaccggttcatcctttaactaaccttccagcatgacaatcatccagcaccacgtc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7478466 |
aggagcaagcaaacatcatagcatgattcttcatgtcatagacaaaaccggttcatcctttaactaaccttccagcatgacaatcatccagcaccgcgtc |
7478565 |
T |
|
| Q |
114 |
taaatagatgttgattatttaaaggtcatgttaaccggtgtttcagaagcattgattaagtgagcgaaaagagaaagaattatgtaaaagagaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |||||| |||||||||| |||||||| ||| || ||||||||| |||| |
|
|
| T |
7478566 |
taaatagatgttgattatttaaaggtcatgttaaccggtatttcggaagcaccgattaagtgaacgaaaaga-aaaaaaatatgtaaaaaagaa |
7478658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 320 - 435
Target Start/End: Original strand, 7478963 - 7479078
Alignment:
| Q |
320 |
ttttacttgtgattgtagcattactagttttgatcaagatagctggttgctagggtcagttggtgaagcagacactataataagaagaggaaagaaggca |
419 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7478963 |
ttttacatgtgattgtagcattactagttttgatcaagatagctggttgctagggtcagttggtgaagcagacactataataagaagaggaaagaaggca |
7479062 |
T |
|
| Q |
420 |
ttttgagtttggtatt |
435 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7479063 |
ttttgagtttggtatt |
7479078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 273 - 328
Target Start/End: Original strand, 7478724 - 7478779
Alignment:
| Q |
273 |
cttaacctgtgtttgagagcaaccgttaacattttcttaagtaaccattttacttg |
328 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7478724 |
cttaacctgtgtttgagagtaaccattaacattttcttaagtaaccattttacttg |
7478779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University