View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6493_low_7 (Length: 205)
Name: NF6493_low_7
Description: NF6493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6493_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 24 - 190
Target Start/End: Complemental strand, 51769157 - 51768991
Alignment:
| Q |
24 |
atgtaatgttaagtaacgatgaacatgtttataattttctataataccacataataaactaatactacattcatatgatgaaatgtcataaaaattcaaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51769157 |
atgtaatgttaagtaacgatgaacatgtttataattttctataataccacataataaactaatactacattcatatgatgaaatgtcataaaaattcaag |
51769058 |
T |
 |
| Q |
124 |
aatgcatctagaactagaatatacctctcaaacttatacgcaaacttgcaatttattcaagcctttg |
190 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51769057 |
aatgcatctagaactagaatctacctctcaaacttatacgcaaacttgcaatttattcaagcctttg |
51768991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University