View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6494_high_14 (Length: 239)
Name: NF6494_high_14
Description: NF6494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6494_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 15 - 186
Target Start/End: Original strand, 34127545 - 34127716
Alignment:
| Q |
15 |
agaacctgtggcacttgataggtatttcaaagatttgattttaatttcttattcaagaatgagctggcggcttgactccatttattcatttatgacttaa |
114 |
Q |
| |
|
||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34127545 |
agaacatgtggcacatgataggtattttaaagatttgattttaatttcttattcaagaatgagctggcggcttgactccatttattcatttatgacttaa |
34127644 |
T |
 |
| Q |
115 |
ccgatccaaggcctaaagtttttcatgtattaaccaagctattgagctctagagttacaccaaggacaaatt |
186 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34127645 |
ccgatccaagacctaaagtttttcatgtattaaccaagctattgagctctagagttacaccaaggacaaatt |
34127716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University