View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6494_high_8 (Length: 355)
Name: NF6494_high_8
Description: NF6494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6494_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 28276790 - 28276968
Alignment:
| Q |
1 |
ctacctgtccatgttctaaattggatttgatgttaatatggagaaacatcatgtctttaggatcagccagttattataaggtggcttattgtgatattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28276790 |
ctacctgtccatgttctaaattggatttgatgttaatatggagaaacatcatgtctttaggatcagccagttattataaggtggcttattgtgatattat |
28276889 |
T |
|
| Q |
101 |
attattgaatcaagttggcattcgatggcaacaattaagatatgatttctccacg-taataggtactaaatactctttt |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
28276890 |
attattgaatcaagttggcatgcgatggcaacaattatgatatgatttctccatgttaataggtactaaatactctttt |
28276968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 337
Target Start/End: Original strand, 28277021 - 28277074
Alignment:
| Q |
283 |
ttcaaaccatatcaactactttttggcttttagtgtatcatgccaattaggtatc |
337 |
Q |
| |
|
||||||| |||||||||||||||||| |||| ||| ||||| ||||||||||||| |
|
|
| T |
28277021 |
ttcaaactatatcaactactttttgg-ttttggtgcatcataccaattaggtatc |
28277074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University