View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6494_low_10 (Length: 441)
Name: NF6494_low_10
Description: NF6494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6494_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 2e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 2e-84
Query Start/End: Original strand, 241 - 431
Target Start/End: Original strand, 15155368 - 15155558
Alignment:
| Q |
241 |
cgatgctcgcgagtgtttgggactaggttattgcgatggtttccacacttttttatacaatattgtttggttaaaagaacgaggaaaattcgaaagatgt |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| || |||| |||||||||||||||||||| |
|
|
| T |
15155368 |
cgatgctcgcgagtgtttgggactaggttattgtgatggttttcacacttttttatacaatattgtttggtgaatagaatgaggaaaattcgaaagatgt |
15155467 |
T |
 |
| Q |
341 |
aatcccataaaagaaacaactaattttactacaatttgagtaggtacaacacggtggaatgtgattattcttcacaagagcgtgatgatgt |
431 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15155468 |
aatcccatagaagaaacaaccaattttactacaatttgagtaggtacaacacggtggaatgtgattattcttcacaagagcgggatgatgt |
15155558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University