View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6494_low_16 (Length: 293)
Name: NF6494_low_16
Description: NF6494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6494_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 283
Target Start/End: Complemental strand, 14185364 - 14185100
Alignment:
| Q |
19 |
atagtagttttttcattgttttttatcttgcaaagtaaactggttgtcgtataattttttctttaaatagtatttacacacatatatgtgatcatagtga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14185364 |
atagtagttttttcattgttttttatcttgcaaagtaaactggttgtcgtataattttttctttaaatagtatttacacacatatatgtgatcatagtga |
14185265 |
T |
 |
| Q |
119 |
ggggtaaggaggtatgctacacttgaaattgtgtagccttttgtatctatatatgattgggtacctctgtattgcgtgaaggtatgatggtgtctaaaga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
14185264 |
ggggtaaggaggtatgctacacttgaaattgtgtagccttttgtatctatatatgattgggtacccctatattgcgtgaaggtatgatggtgtctaaaga |
14185165 |
T |
 |
| Q |
219 |
aaatgtgctggtattagtcaacatgtagtcaaatttatatgggaaatgccaatgagtaccctatg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14185164 |
aaatgtgctggtattagtcaacatgtagtcaaatttatatgggaaatgccaatgagtaccctatg |
14185100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University