View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6494_low_17 (Length: 274)
Name: NF6494_low_17
Description: NF6494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6494_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 26031159 - 26031395
Alignment:
| Q |
17 |
aggttttaaataaagggcgtgataacggttgtgtcgtgatctttggtaccgcggtaccacagagaattgcagtcaaatgaaattaatgtggcttcaattg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26031159 |
aggttttaaataaagggcgtgataacggttttgtcgtgatctttggtaccgcggtaccacagagaattgcaatcaaatgaaattaatgtggcttcaattg |
26031258 |
T |
 |
| Q |
117 |
ctgccgcgttatgttgctcagatcgcgtacacaaacctttgtttaaaaccttgattactacactcctaatttgattttcttcatttgtttatatggtttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26031259 |
ctgccgcgttatgttgctcagatcgcgtacacaaacctttgtttaaaaccttgattactacactcctaatttgattttcttcatttgtttatatggtttt |
26031358 |
T |
 |
| Q |
217 |
gtgattgaatttatgattagaattgtcaaaattgctg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26031359 |
gtgattgaatttatgattagaattgtcaaaattgctg |
26031395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University