View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6494_low_22 (Length: 235)
Name: NF6494_low_22
Description: NF6494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6494_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 14 - 209
Target Start/End: Original strand, 1104981 - 1105176
Alignment:
| Q |
14 |
aagaatatgtgattgggtttaatataaccatgtaaaatcgatttgtaagatgaggattgtgtacgtcctcatgttcagcactattgagtttaatgcatag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| ||| |
|
|
| T |
1104981 |
aagaatatgtgattgggtttaatataaccatgtaaaatcgatttgtaagatgaggattgtgtacgtcctcatgctcaacactattgagtttaatgcgtag |
1105080 |
T |
|
| Q |
114 |
atataaatgttagatgacttgatagcaaaaacctaagaataagtggtccaacaaatctcagaatagactgatcttatatcattttaaaatttgcaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| ||| ||||||||||| ||||||||||| ||||||||| |
|
|
| T |
1105081 |
atataaatgttagatgacttgatagcagaaacctaataataagtggtccaacaaatcttagagtagactgatctgatatcattttagaatttgcaa |
1105176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University