View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6495_low_3 (Length: 216)
Name: NF6495_low_3
Description: NF6495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6495_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 44 - 197
Target Start/End: Complemental strand, 9871149 - 9871001
Alignment:
| Q |
44 |
tcacttgtcaaagcttcttagacttgaactcttttttctaaaggaaaattatttttggtatgccgataactcttgtgctgtatcaatttttccctttaaa |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||| || ||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9871149 |
tcacttgtcaaagcttcttagacttgaactcttttctttaatt-----tttttttttctataccgataactcttgtgctgtatcaatttttccctttaaa |
9871055 |
T |
|
| Q |
144 |
ctattgacgatgacatatatatttgaccttggagttattgtttatacttataat |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
9871054 |
ctattgacgatgacatataaatttgaccttggaattattgtttatacttataat |
9871001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 95 - 176
Target Start/End: Complemental strand, 9876642 - 9876561
Alignment:
| Q |
95 |
tttttggtatgccgataactcttgtgctgtatcaatttttccctttaaactattgacgatgacatatatatttgaccttgga |
176 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||| |||||||||||||||| || | |||| |||||||||||||||||| |
|
|
| T |
9876642 |
tttttggtatgtcgataactcttgtgatatatcaacgtttccctttaaactatagaaggtgacgtatatatttgaccttgga |
9876561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University