View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6497_high_12 (Length: 253)
Name: NF6497_high_12
Description: NF6497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6497_high_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 20 - 253
Target Start/End: Complemental strand, 6993322 - 6993089
Alignment:
| Q |
20 |
ctgggttcatgctcaatggttctattcctgagtggtttggtgagaagcttggtgcactaaaagagcttgatttaaggtcttgttcaatatctggtgtgat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6993322 |
ctgggttcatgctcaatggttctattcctgagtggtttggtgagaagcttggtgcactaaaagagcttgatttaaggtcttgttcaatatctggtgtgat |
6993223 |
T |
 |
| Q |
120 |
tcctggttcacttgggggcatgagaagtttgaagaagttgtttctttcaaggaacaatcttactagtagagtgccttcaggtttggggttgttatctaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6993222 |
tcctggttcacttgggggcatgagaagtttgaagaagttgtttctttcaaggaacaatcttactagtagagtgccttcaggtttggggttgttatctaat |
6993123 |
T |
 |
| Q |
220 |
ctttctattctcgatctctctaggaatctgcttt |
253 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||| |
|
|
| T |
6993122 |
ctttctattcttgatctctctaggaatttgcttt |
6993089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University