View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6497_high_14 (Length: 247)
Name: NF6497_high_14
Description: NF6497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6497_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 19 - 196
Target Start/End: Complemental strand, 48947589 - 48947412
Alignment:
| Q |
19 |
caaatggttatagtagagcacaaattccatgcataatgaaaacttcatcagcctgatgtttattttcaaatgttctagattagacattttccaacaggtc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48947589 |
caaatggttatagtagagcacaaattccatgcataatgaaaacttcatcagcctgatgtttattttcaaatgttctagattagacattttccaacaggtc |
48947490 |
T |
 |
| Q |
119 |
gcattttaaagatattaggcctaaaatggaagttagttagaaataaagcataaagttgaagttgatacaacagatttt |
196 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
48947489 |
gcattttagagatattaggcctaaaatggaagttagttagaaataaagcataaagttgaagttgatagaacaaatttt |
48947412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University