View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6497_low_12 (Length: 270)
Name: NF6497_low_12
Description: NF6497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6497_low_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 156 - 270
Target Start/End: Original strand, 29789657 - 29789771
Alignment:
| Q |
156 |
gacttggcaataattatttgtttgggctacctttaatgtgacaagatatacaaaacattgggatttattggtgagtaaatacaaaagatttgtatcatag |
255 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29789657 |
gactttgcaataattatttgtttgggctacctttaatgtgacaagatatacaaaacattgagatttattggtgagtaaatacaaaagatttgtatcatag |
29789756 |
T |
 |
| Q |
256 |
ggtagcctttaatcc |
270 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29789757 |
ggtagcctttaatcc |
29789771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 50 - 160
Target Start/End: Complemental strand, 6943408 - 6943298
Alignment:
| Q |
50 |
agcttcttctgtttgctaacctcctggacgtttatggaaaatccaataccttttcatgaatgcctgtaattatcaagaggtaagtttcaatcatttatct |
149 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
6943408 |
agcttcttctgtttgctaacctcccggacgtttatggaaaatccaatacctcttcatgaatgcctgtaattatcatgaggtaagtttcaatcattaatct |
6943309 |
T |
 |
| Q |
150 |
cttggagactt |
160 |
Q |
| |
|
||||||||||| |
|
|
| T |
6943308 |
cttggagactt |
6943298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 50 - 123
Target Start/End: Complemental strand, 6940212 - 6940139
Alignment:
| Q |
50 |
agcttcttctgtttgctaacctcctggacgtttatggaaaatccaataccttttcatgaatgcctgtaattatc |
123 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6940212 |
agcttcttctgtttgctaacctcccggacgtttatggaaaatccaataccttttcatgaatgcctgtaattatc |
6940139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 16 - 108
Target Start/End: Original strand, 6787366 - 6787458
Alignment:
| Q |
16 |
catgtcttgacttaactgccaagttttctaaatcagcttcttctgtttgctaacctcctggacgtttatggaaaatccaataccttttcatga |
108 |
Q |
| |
|
|||||| || |||||| |||||||||| |||||||||| || ||||||||||||||| |||||||||||||| ||||||| ||||||||||| |
|
|
| T |
6787366 |
catgtcctgtcttaacaaccaagttttcaaaatcagcttgttttgtttgctaacctcccggacgtttatggaatatccaattccttttcatga |
6787458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University