View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6497_low_14 (Length: 252)
Name: NF6497_low_14
Description: NF6497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6497_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 48947021 - 48946779
Alignment:
| Q |
1 |
ttttgacaacacttttcagtgggaatattgagattatgttacatttatgttagttatgtgatgtgagtaacttttatatatgcacatacatagtaccttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
48947021 |
ttttgacaacacttttcagtgggaatattgagattatgttacatttatgttagttatgtgatgtgagtaacttttatatatgta------tagtaccttc |
48946928 |
T |
|
| Q |
101 |
gctagtttccttgtggcatgtggtgtgttacttggtagtaatttgaaaagatgtctttgctttgaatttgttaccacatatctaaacatgtggaattcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48946927 |
gctagtttccttgtggcatgtggtgtgttacttggtagtaatttgaaaagatgtctttgctttgaatttgttaccacatatctaaacatgtggaattcat |
48946828 |
T |
|
| Q |
201 |
caaa-------ggtcatgtattagcacttctttatattgcccttttcat |
242 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48946827 |
caaagtttaatggtcatgtattagcacttctttatattgcccttttcat |
48946779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University