View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6497_low_17 (Length: 223)
Name: NF6497_low_17
Description: NF6497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6497_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 11 - 197
Target Start/End: Original strand, 14041447 - 14041627
Alignment:
| Q |
11 |
gaagaatattattggtatcaacaaacaaaaagtaaatggttggtactagacgatcaaaacactcatttctttcatatatcaagtcttctgagaagnnnnn |
110 |
Q |
| |
|
||||||| ||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
14041447 |
gaagaatgttatttgtatcaacaagcaaaaagtaaatggttggtactaggcgatcaaaacactcatttctttcatatatcaagtcttctgagatg-gaag |
14041545 |
T |
 |
| Q |
111 |
nnntataaatatttctctccatgacgacgatgatgatcatataataatgaaatttataacgagggtaatcttcaaagaatggttgtt |
197 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14041546 |
atatataaatatttttctcaatgacgacgatgatg-----ataataattgaatttataacgagggtaatcttcaaagaatggttgtt |
14041627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University