View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6497_low_17 (Length: 223)

Name: NF6497_low_17
Description: NF6497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6497_low_17
NF6497_low_17
[»] chr6 (1 HSPs)
chr6 (11-197)||(14041447-14041627)


Alignment Details
Target: chr6 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 11 - 197
Target Start/End: Original strand, 14041447 - 14041627
Alignment:
11 gaagaatattattggtatcaacaaacaaaaagtaaatggttggtactagacgatcaaaacactcatttctttcatatatcaagtcttctgagaagnnnnn 110  Q
    ||||||| ||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |         
14041447 gaagaatgttatttgtatcaacaagcaaaaagtaaatggttggtactaggcgatcaaaacactcatttctttcatatatcaagtcttctgagatg-gaag 14041545  T
111 nnntataaatatttctctccatgacgacgatgatgatcatataataatgaaatttataacgagggtaatcttcaaagaatggttgtt 197  Q
       ||||||||||| |||| |||||||||||||||     ||||||||  |||||||||||||||||||||||||||||||||||||    
14041546 atatataaatatttttctcaatgacgacgatgatg-----ataataattgaatttataacgagggtaatcttcaaagaatggttgtt 14041627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University