View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6497_low_8 (Length: 362)
Name: NF6497_low_8
Description: NF6497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6497_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 18 - 357
Target Start/End: Original strand, 32643584 - 32643923
Alignment:
| Q |
18 |
accataaccttgtctcaaaagtaacagttctacaaggcactgttatcaatgctcttgtgaatgaagctgtaacatgcttgcaaattttgggaaaggatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32643584 |
accataaccttgtctcaaaagtaacacttctacaaggcactgttatcaatgctcttgtgaatgaagctgtaacttgcttgcaaattttgggaaaggatga |
32643683 |
T |
 |
| Q |
118 |
acctgccatcccaattgggggtggattgcccttgactacaaggctcgtgaaaaaggacatctctcttcagatgttcatcttgaaacggtacacggcaata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
32643684 |
acctgccatcccaattgggggtggattgcccttgaccacaaggctcgtgaaaaaggacatctctcttcagatgttcatcttgaaaaggcacacggcaata |
32643783 |
T |
 |
| Q |
218 |
accggcataaaaaatgttctaaataacacatgcactcgaatttttaatgatgttttgcagatagttttgaaaagcaaaattatgattgcaacacgaggta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32643784 |
accggcataaaaaatgttctaaataacacatgcactcgaatttttaatgatgttttgcagatagttttgaaaagcaaaattatgattgcaacacgaggta |
32643883 |
T |
 |
| Q |
318 |
ccacatcacgaattcacacactcaatatgcctttgcttct |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32643884 |
ccacatcacgaattcacacactcaatatgcctttggttct |
32643923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University