View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6498_low_14 (Length: 247)
Name: NF6498_low_14
Description: NF6498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6498_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 40187165 - 40187383
Alignment:
| Q |
1 |
acaaagttggaattacagcccctattattataacagtggggtactggtggcagatacatgtcctctagttaggaagtattgtaggggtccagagcagtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40187165 |
acaaagttggaattacagcccctattattataacagtggggtactggtggcagatacatgtcctctagttaggaagtattgtaggggtccagagcagtat |
40187264 |
T |
|
| Q |
101 |
ctacgaactgtttttgaagtgactgaaaggagctagatggatgaaggattttgtctatgccccgtgaatatttacaagtgaaaaatctcagtaatttttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40187265 |
ctacgaactgtttttgaagtgactgaagggagctagatggatgaaggattttgtctatgccccgtgaatatttacaagtgaaaaatctcagtaatttttg |
40187364 |
T |
|
| Q |
201 |
ttaaaattactttgacaag |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40187365 |
ttaaaattactttgacaag |
40187383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University