View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6498_low_7 (Length: 408)
Name: NF6498_low_7
Description: NF6498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6498_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 4 - 388
Target Start/End: Complemental strand, 3864763 - 3864382
Alignment:
| Q |
4 |
tgatattgatgcttgatttgttataattgaacttcttcaggttactacacttttccaaggctatcccgaccttcttgacgagtttactcatttccttcaa |
103 |
Q |
| |
|
|||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3864763 |
tgatattgatacttgatttgtcataattgaacatcttcaggttactacacttttccaaggctatcccgaccttcttgacgagtttactcatttccttcaa |
3864664 |
T |
|
| Q |
104 |
aaaactatttcttctcaagttactgctcaaaactctatgcctcaagatatataggaggtctccaatatccagcattggaaaatttggaaggagcaaaatt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
3864663 |
aaaactatttcttctcaagttactgctcaaaactctatgcctcaagatatataggaggtctccaatacccagcattggaaaatttggaaggagcgaaatt |
3864564 |
T |
|
| Q |
204 |
atagaatattcaataatagtgtcaaggaggttgatggaattgtcaatgtaataaaggttttttctttcaccttggcgttggagtttaagttggttgaagg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3864563 |
atagaatattcaataatagtgtcaaggaggttgatggaattgtcgatgtaataaaggttt----tttcaccttggcgttggagtttaagttggttgaagg |
3864468 |
T |
|
| Q |
304 |
tggcggcttcattgtaccatgagtggtgttggaacctg-gagagtgtttattgagacaatagtgttggggggctatgcattgggtg |
388 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3864467 |
tggcggcttcactgtaccataagtggtgttggaacctgagggagtgtttattgagacaatagttttggggggctatgcattgggtg |
3864382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University