View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6498_low_9 (Length: 336)
Name: NF6498_low_9
Description: NF6498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6498_low_9 |
 |  |
|
| [»] scaffold0045 (5 HSPs) |
 |  |  |
|
| [»] scaffold0457 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0045 (Bit Score: 215; Significance: 1e-118; HSPs: 5)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 8 - 319
Target Start/End: Complemental strand, 39945 - 39634
Alignment:
| Q |
8 |
catcttcaatttgcatcaacccatccattagatcaactgtactttccaccttattttcattctttcttttacctaactccatccaaaaaatgtcctcaag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39945 |
catcttcaatttgcatcaacccatccattagatcacttgtacttttcaccttattttcattctttcttttacctaactccatccaaaaaatgtcctcaag |
39846 |
T |
 |
| Q |
108 |
ctttcttctacactaaaattttaaggagtgtacatgtttattattaattagtccaa---caatactacataatataaaggatttataactgaagcaaact |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||| | ||||| | ||| | ||||| |||||||||||||||||| |
|
|
| T |
39845 |
ctttcttctacactaaaattttaaggagtgtacatgtttattataa---agtccaaaattagtactaaagaatgtcaaggaattataactgaagcaaact |
39749 |
T |
 |
| Q |
205 |
ttttgataattgaaatggaaatttaatttagacacaaaccttgagagcatgatggtatgcaaaaccaggaatattaagtggataggctcgtagtccttga |
304 |
Q |
| |
|
| |||||||||||||||||||||||||||| ||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39748 |
tgttgataattgaaatggaaatttaatttatacatgaaccttaagagcatggtggtatgcaaaaccaggaatattaagtggataggctcgtagtcctgga |
39649 |
T |
 |
| Q |
305 |
accatgccttcatag |
319 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39648 |
accatgccttcatag |
39634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 2 - 132
Target Start/End: Complemental strand, 25354 - 25227
Alignment:
| Q |
2 |
catcatcatcttcaatttgcatcaacccatccattagatcaactgtactttccaccttattttcattctttcttttacctaactccatccaaaaaatgtc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| || ||||||||| ||| |||| ||||||| |||| ||| |
|
|
| T |
25354 |
catcatcatcttcaatttgcatcaacccatccattagatcaattgt---ttccaccttatctttattctttctgttatctaattccatcccgaaaaagtc |
25258 |
T |
 |
| Q |
102 |
ctcaagctttcttctacactaaaattttaag |
132 |
Q |
| |
|
||||||||||||||||||| |||||||||| |
|
|
| T |
25257 |
atcaagctttcttctacactgaaattttaag |
25227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 8 - 129
Target Start/End: Complemental strand, 32558 - 32440
Alignment:
| Q |
8 |
catcttcaatttgcatcaacccatccattagatcaactgtactttccaccttattttcattctttcttttacctaactccatccaaaaaatgtcctcaag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||| |||||||| |||| ||||||||||| |||||||| | |
|
|
| T |
32558 |
catcttcaatttgcatcaacccatccattagatcacttgt---ttcaaccttattttcagcttttcttttctctaattccatccaaaagatgtcctccaa |
32462 |
T |
 |
| Q |
108 |
ctttcttctacactaaaatttt |
129 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
32461 |
ctttcttctacactgaaatttt |
32440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 248 - 293
Target Start/End: Complemental strand, 32053 - 32008
Alignment:
| Q |
248 |
agagcatgatggtatgcaaaaccaggaatattaagtggataggctc |
293 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32053 |
agagcatggtggtatgcaaaaccaggaatgttaagtggataggctc |
32008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 248 - 293
Target Start/End: Complemental strand, 25075 - 25030
Alignment:
| Q |
248 |
agagcatgatggtatgcaaaaccaggaatattaagtggataggctc |
293 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
25075 |
agagcatggtggtatgcaaaaccaggaatgttaattggataggctc |
25030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0457 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: scaffold0457
Description:
Target: scaffold0457; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 2 - 131
Target Start/End: Original strand, 4870 - 4996
Alignment:
| Q |
2 |
catcatcatcttcaatttgcatcaacccatccattagatcaactgtactttccaccttattttcattctttcttttacctaactccatccaaaaaatgtc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||||||| || ||| ||||| ||| ||| || ||||| |||| ||| |
|
|
| T |
4870 |
catcatcatcttcaatttgcatcaacccatccattagatcaattg---tttccaccttatctttattttttctgttatctatttcaatccagaaaaagtc |
4966 |
T |
 |
| Q |
102 |
ctcaagctttcttctacactaaaattttaa |
131 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
4967 |
atcaagctttcttctacactgaaattttaa |
4996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0457; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 248 - 293
Target Start/End: Original strand, 5093 - 5138
Alignment:
| Q |
248 |
agagcatgatggtatgcaaaaccaggaatattaagtggataggctc |
293 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
5093 |
agagcatggtggtatgcaaaaccaggaatgttaattggataggctc |
5138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University