View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6499_low_10 (Length: 324)
Name: NF6499_low_10
Description: NF6499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6499_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 317
Target Start/End: Original strand, 43194787 - 43195103
Alignment:
| Q |
1 |
tccaccatgtaactcttggcgtttctttctcttctcttcctccgtcaacgaaggatcattctcgatagcgcgaatagcagagacaagatcccccgcaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43194787 |
tccaccatgtaactcttggcgtttctttctcttctcttcctccgtcaacgaaggatcattctcgatagcgcgaatagcagagacaagatcccccgcaaca |
43194886 |
T |
 |
| Q |
101 |
gacggagcagcagaagcagcaacaacatcacttggttgagcacaatcaggacacaaccaatcgagcatttcacttgttgttggaacaacagggagacaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43194887 |
gacggagcagcagaagcagcaacaacatcacttggttgagcacaatcaggacacaaccaatcgagcatttcacttgttgttggaacaacagggagacaag |
43194986 |
T |
 |
| Q |
201 |
gagcatgccatggtgttgtgcaggttttgcaatgaagtgtttcggtttctgatggtttttgtttgcagaccatgcatacaccgtcagcgtcacaaggaag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43194987 |
gagcatgccatggtgttgtgcaggttttgcaatgaagtgtttcggtttctgatggtttttgtttgcaaaccatgcatacaccgtcagcgtcacaaggaag |
43195086 |
T |
 |
| Q |
301 |
gtggtgagtgatgatgt |
317 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43195087 |
gtggtgagtgatgatgt |
43195103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University