View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6500_high_9 (Length: 255)

Name: NF6500_high_9
Description: NF6500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6500_high_9
NF6500_high_9
[»] chr1 (1 HSPs)
chr1 (20-242)||(48951560-48951782)


Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 20 - 242
Target Start/End: Complemental strand, 48951782 - 48951560
Alignment:
20 gtcttgttctataggagaaggcccacttctcagtaattgcaggtcatcctttgcaaagatatcactctactgagcacctgtattagataaattattaaat 119  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48951782 gtcttgttctataggagaaggctcacttctcagtaattgcaggtcatcctttgcaaagatatcactctactgagcacctgtattagataaattattaaat 48951683  T
120 agatgaatgtctgatatgaacagtagtagtgcccagctgattacaaaccttctaggataaatgagccaacagggtctaattcacctgactcaaggggctc 219  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||| |||||    
48951682 agatgaatgtctgatatgaacagtagtagtgcccagctgattacaaaccttctaggataaatgagccaacagggtctaattcaggtgactcaagcggctc 48951583  T
220 gtccgaaccaacttggctgacct 242  Q
    |||||||||||||||||||||||    
48951582 gtccgaaccaacttggctgacct 48951560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University