View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6501_high_18 (Length: 233)
Name: NF6501_high_18
Description: NF6501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6501_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 63 - 213
Target Start/End: Original strand, 3895045 - 3895195
Alignment:
| Q |
63 |
ctatgcttatgaggtaaaagacagaaccaatgaagcagcaggttctgtgtgggataaagccagagaaggaacaaatagggctgcagagaaggctgagaat |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3895045 |
ctatgcttatgaggtaaaagacagaaccaatgaagcagcaggttctgtgtgggataaagccagagaaggaacaaatagggctgcagagaaggctgagaat |
3895144 |
T |
 |
| Q |
163 |
gctggagagaaggctagagattatgcttatgatgcaaaggagagaacaaag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3895145 |
gctggagagaaggctagagattatgcttatgatgcaaaggagagaacaaag |
3895195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 100 - 194
Target Start/End: Original strand, 3894962 - 3895056
Alignment:
| Q |
100 |
gcaggttctgtgtgggataaagccagagaaggaacaaatagggctgcagagaaggctgagaatgctggagagaaggctagagattatgcttatga |
194 |
Q |
| |
|
|||||||| ||||||| ||||||| |||||||||| | || |||||||||||||| ||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
3894962 |
gcaggttcaatgtgggagaaagccaaagaaggaacagacagagctgcagagaaggcagagaatgctggagagaaagctagagactatgcttatga |
3895056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 3895271 - 3895323
Alignment:
| Q |
157 |
gagaatgctggagagaaggctagagattatgcttatgatgcaaaggagagaac |
209 |
Q |
| |
|
|||| |||||| ||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3895271 |
gagagtgctggggagaaagctagagattatgcttatgatgcaaaggaaagaac |
3895323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University